Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_330E9-3
Clone ID CMHD-GT_330E9-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_330E9-3
Sequence
TTGCAGCACCAATGGAACAGTGATCAATAAGCTGCAAGTTGTTAAGAAGCAGACTTACCCTTTACAGAGCGGGGATATCA
TCTATTTGGTGTACAGGAAGAATGAGCCAGAACACAATGTGGCATACCTCTATGAATCTTTAAGTGGCAAACAGAGCTTA
ACTCAAGACTCCCTTGAAGCCAATAAGGAAAATATGTTCCATGTGACCAAAGATTGCTCAGGTCCAGGGCAGGGTGATGA
TCCCCAGGTTCCACTATTGTCACCCATGGCTCAGACATGCTTAGAGGAACCACAGCCATCAACATCGACATCAGACCTCC
TCCCCACGGCCTCTACCTCTTCTACGGAGCCAGAGCTGACCTCTGCAGGGC
Sequence Type mRNA
Unitrap ID UNI30461

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 110572567..110573985 196
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014668 (Chfr) NM_172717 checkpoint with forkhead and ring finger domains Gene [Source:MGI Symbol;Acc:MGI:2444898]

 
Come back to gene ENSMUSG00000014668


For any suggestions or comments, please send an email to unitrap@crg.es