Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_330B10-3
Clone ID CMHD-GT_330B10-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_330B10-3
Sequence
AGGCGTCAGGCGGCCCCCACATCGTGCGCATCCTGGACGTGTATGAGAATATGCACCACGGCAAGCGCTGTCTCCTCATC
GTCATGGAATGCATGGAGGGTGGTGAGCTGTTCAGCAGGATTCAGGAGCGTGGTGACCAGGCTTTCACTGAGAGAGAGGC
TGCAGAGATAATGCGGGACATTGGCACTGCCATCCAGTTCTTGCACAGCCGGAACATTGCCCACCAAAATGACAAGCACT
GAAAACCTACTCTATACATCCAAGGAGAAGGATGCTGTACTTAAACTCACCGATTTTGGCTTTGCCAAGGAAACCACCCA
AAATGCCCTCCAGACACCCTGCTACACTCCCTATTATGTGGCTCCTGAGGTCCTGGGTCCAGAGAAGTATGACAAGTCCT
GTGATATGTGGTCCCTGGGCGTCATCATGTACATCCTTTTGTGTGGATTCCCACCCTTCTACTCCAACACCGGCCAGGCC
ATCTCTCCAGGAATGAAAAGAAGGATTCGCTTGGGCCAGTATAGCTTCCCTAACCCTGAATGGTTAGATGTCTCTGAGGA
TGCCAACCATGTAGTCCC
Sequence Type mRNA
Unitrap ID UNI18469

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 107160661..107166046 125
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032577 (Mapkapk3) NM_178907 mitogen-activated protein kinase-activated protein kinase 3 Gene [Source:MGI (curated);Acc:Mapkapk3-001]

 
Come back to gene ENSMUSG00000032577


For any suggestions or comments, please send an email to unitrap@crg.es