Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_258C04-3
Clone ID CMHD-GT_258C04-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_258C04-3
Sequence
GTCGGGGTCTTTCAGTAAAAGCAACAATTGAGCAATTCATGAAGATCTTAGGAGGAGATTGACACAATGGTCCTACCAGA
ACAATTTAAAGACAGCAGGCTAAAAAGGAAGAATTTGGTGAAAAAGGTTCAGGTGTTCTTAGCAGAGTGTGACACAGTGG
AGCAATACATCTGCCAAGAGACAGAGCGGCTGCAGTCTACAAACTTGGCCCTGGCTGAATGAAGTGCAGTGGAGAGTGGC
TGTACTGGCCTGAAAAGCACCTTTACAGCCCTGCCCTCTCTGGAACAGAAGTCGCCTGTTTCTCCATGGCTGCCAGGGGC
AACTAGCCAAATGTCAATTTCCCTGCTCCTCCGTCGGTTCTCAATGAAAAAGTCCTGTCTTTGCAACCTG
Sequence Type mRNA
Unitrap ID UNI13748

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 40883452..40886164 257
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028416 (Bag1) NM_009736 BCL2-associated athanogene 1 Gene [Source:MGI (curated);Acc:Bag1-001]

 
Come back to gene ENSMUSG00000028416


For any suggestions or comments, please send an email to unitrap@crg.es