Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_296C2-3
Clone ID CMHD-GT_296C2-3
Vector pMS3
Project cmhd

Sequence tag CMHD-GT_296C2-3
Sequence
TCCGGGAGGAGAAGGACGATCTGATCGGCTGGATGCCGCATTATCAAAAGGCGGTCCGAGCGAACGAGTGCGTCCAGAAT
CAGCATGTGTTACATAGAAATCTCATTTATTTAGCTACCATCGCATACGCCAACACAATCATTCTCACAAAGGCAGTGGA
GTACTTTTCCAGAAGGCTGTAATGAGGACTGATTGGAACCCATCTCCTGGGAATCAGAAAGCTGCTCAGAACATGGGCAA
AAAGTCCCATTCATTTTAGACTGTGAAGAAACTCGCTACCAACTCTACTGTATTCTGACTATAAATATTTATTAATAAAA
CAGATCCCACGGTAGAACCTGAGGACCTGCGAGGACCTGAGGTGTATGACAGCGGTGTCATTGTCAACAATAGTGATTAT
CTGATGACATGTAATAAATGATACACGTCCGAC
Sequence Type mRNA
Unitrap ID UNI30472

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 121619758..121622037 343
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032526 (Deb1) NM_026794 differentially expressed in B16F10 1 Gene [Source:MGI Symbol;Acc:MGI:1349474]

 
Come back to gene ENSMUSG00000032526


For any suggestions or comments, please send an email to unitrap@crg.es