Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_298G12-3
Clone ID CMHD-GT_298G12-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_298G12-3
Sequence
TCTCTACGCTTAGATGCCAACCATATTACCTCAGTCCCGGAGGACAGTTTTGAAGGGCTCGTTCAGTTGCGGCATCTGTG
GCTGGATGACAACATCTTGACGGAAGTGCCTGTGCGTCCGCTCAGCAACCTGCCAACCCTGCAGGCGCTGACCTTGGCTC
TCAACAACATCTCAAGCATCCCCGACTTCGCATTCACCAACCTTTCAAGCTTGGTAGTGCTGCATCTTCATAAC
Sequence Type mRNA
Unitrap ID UNI30473

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 109836711..109836939 219
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050199 (Lgr4) NM_172671 leucine-rich repeat-containing G protein-coupled receptor 4 Gene [Source:MGI (curated);Acc:Lgr4-002]

 
Come back to gene ENSMUSG00000050199


For any suggestions or comments, please send an email to unitrap@crg.es