Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone DD0952
Clone ID DD0952
Vector pGT1lxrT2
Project sanger

Sequence tag DD0952
Sequence
CTTTCTTTCTGTAACTCAGCGGTCATGGGAGTTTCTATGTGATGTGTTCTGCGTGACTCTACTGGGTGTTGTGAGAGAAG
GTTAGTCAAGCTCAGAACTCCAAACATGTGTCTTCGCTGGATGCTGTGAATTTAGCTCAAGCAAGCTCAGAACTTCACAC
ATG
Sequence Type mRNA
Unitrap ID UNI1239

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 177691913..177692016 104
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078862 (OTTMUSG00000016327) predicted gene, OTTMUSG00000016327 Gene [Source:MGI Symbol;Acc:MGI:3709298]

 
Come back to gene ENSMUSG00000078862


For any suggestions or comments, please send an email to unitrap@crg.es