Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_298C11-3
Clone ID CMHD-GT_298C11-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_298C11-3
Sequence
ACAGGCTTATCCCACACACCGAGTGACAAGGCTGTTTCCAGCTACAGAGCTTGTCAACCTCTGCCACCTCAGGACTCAGA
CTCTCACCACAGTTCCAGAGAATGCCAGGGACCCAGATATGGAGCTTCGAGAAGAAGCTTGGTCTCCGGGGCCACTGGAT
TCTGAGGACCAGCATATGGCCAGTCATGATAACCCACCATTAATAGGTTGAAAAACTCACCGGTGGGTTACTTGGATCCT
AGGTGTTTTGGGTAAAACCCATCCTGGTCCACCAACACCCTCCTCCCTCTCCCTGGTGATTCCAGCCTGATGACAAGAAA
GCTCATGCGAAGGCACAGTGGGCCAAGTTGTGTGTCTGACACCTGGAGCAGACGGCATTGGCTTTCTCCATGTTAATAAA
TTGGTGCTTACAACAC
Sequence Type mRNA
Unitrap ID UNI16792

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 6094003..6111007 209
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046792 (Zfp787) NM_001013012 zinc finger protein 787 Gene [Source:MGI Symbol;Acc:MGI:1914359]

 
Come back to gene ENSMUSG00000046792


For any suggestions or comments, please send an email to unitrap@crg.es