Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_298C10-3
Clone ID CMHD-GT_298C10-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_298C10-3
Sequence
GTCTTGGGATCCTACTTGACGTGGCTTTGGGAAACGAGAATTTGGAGATATGGACTCTGACCCAAGATAAGGAGTGTGAC
CTTACAGGCTACCTTCGGGGCAAGCTGCAGTACAAGAACCGGCTTCAGTACATGAAACATTACTTCCCCATCAACTACAG
GATTGCTGTGCCTTATGAGGGGGTACTCATAGTGGCCAACATCACAAGGCTGCAGAAGGCTCACGTGAATGAACAACAGC
TTCGGTACCTGTGGGTCTTGGTGACTCTCAATGCCACTGAATCTGTGATGGAAGTACTTCCCGAGGGCCACCCGTCCTGA
AAGTATCTACAGGATGTTCAAACATTGCTGGAAAACGTACAGCGAAACCTCATGGATGTGAATATTGGCCCTCACGTAGA
AGCTGTGTTATCTCTTCTGACTACTCCAGGCCAAAACCTGAAGCTGGTGCGGCCCAAAACCTTGCTGGACAACTGCTTCC
GGGTCATGGAACTGCTGTACTGTTCTTGCTGTAAACAAAGCCCCATCTTAAAATGGCAGGACTGCGAGCTGCCCAGGCTC
CATCCCCACAGTCCGGGGTCCTTGATGCAATGTACAGCTACAAATGTGTACCCTTTGTCTCGGCAGACCCCCACCTCCCT
GCCCGGATCCCCAAGCTCAAGCCATGGCTCGTTGCCCTGAACAATCTATGTATTGACCCTGGG
Sequence Type mRNA
Unitrap ID UNI23136

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 113266156..113273458 194
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031750 (Il34) NP_001128572 interleukin 34 Gene [Source:MGI Symbol;Acc:MGI:1923777]

 
Come back to gene ENSMUSG00000031750


For any suggestions or comments, please send an email to unitrap@crg.es