Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_297H2-3
Clone ID CMHD-GT_297H2-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_297H2-3
Sequence
CTTTTTGACCACATCCATCCCTGAGGGACCTGGGCACTGCTCAGCGCGGCTAGCGGGGGCCCTTAGCCATGGCCAGCACA
GCGGTCCAGCTCCTAGGCTTCCTGCTTAGCTTCCTGGGCATGGTGGGAACGCTCATCACCACCATTCTGCCACACTGGCG
GAGGACGGCCCATGTGGGCACCAACATCCTGACTGCCGTGTCCTACCTGAAGGGACTGTGGATGGAATGTGTGTGGCACA
GCACAGGCATCTACCAGTGTCAAATCTACCGCTCACTGCTGGCGCTGCCCCGGGATCTGCAGGCCGCCCGGGCGCTCATG
GTCATCTCCTGCCTGTTGTCGGGCATGGCCTGCGCCTGCGCAGTAGTGGGCATGAAGTGCACACGCTGCGCCAAAGGCAC
ACCCGCCAAGACCACCTTTGCAGTGCTGGGGGGCGCACTCTTCCTGCTGGCCGGCCTGCTGTGCATGGTGGCCGTGTCCT
GGACCACGAATGACGTGGTGCAAAATTTTTATAACCCGCTGCTGCCCAGTGGCATGAAGTTTGAAATCGGCCAGGCCCTG
TACCTGGGCTTCATCTCCTCATCCCTGTCTCTCATCGGGGGCACCCTGCTCTGCTTATCCTGCCAGGACAAGGCCCCCTA
CAGACCCTACCCGCCCCAGTCCAGGGCCGGAGCTACCACCACGGCTACCGCCCCTGCCTACCGCCCACCAGCGGCCTACA
AGGACAACCGTGCCCCCTCGGTGACCTCAGCCGC
Sequence Type mRNA
Unitrap ID UNI30483

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 93919516..93920262 722
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047109 (Cldn14) NM_019500 claudin 14 Gene [Source:MGI (curated);Acc:Cldn14-001]

 
Come back to gene ENSMUSG00000047109


For any suggestions or comments, please send an email to unitrap@crg.es