Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_263E6-3
Clone ID CMHD-GT_263E6-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_263E6-3
Sequence
AATGGATGCGTTACATGACTATTCCCATAATTCATTTGACCTGCACTGACAGTTAAGATTCGTTTCCCGGAGATTTGGAG
TTTACGCCGATCTTCAATGACATTGGACAACAGATGGAGCAAAATGCTGCAAGTATAGAACATTGCATTGAAGAAATACA
ATCTGAAGTAAACAAGCTCTGTCCAGATGCGCAGCTACAAACAACAAGTGACTGCTTCAAATGGCTAACTAGTTATAATT
ATAATTTATCTAAGTCACCATCCATTTCCCATGGAGATTTAATAAACTTCCTCAAAACAATGAAAAATTTATTGAATAAT
GAAGACAACCATGAAGAAATGATTCTGGATTTACTCTGGGACCTCTCCTGTCAAAGCAGCATCTCTTTCCTGTCCTCTCT
GGGAGGGACAACCTTCTGTCACCTCTCCAGGACTTCCATACATTCTGTTAAACATTTCTCCTCTGTGGATGTCAAGTCTG
TTTGGGATGATGTAAGATTACATCTTCGACGATTCTTAGTAAACAGGTTAGAAAGATATAATGAAATAAACAATTCACAG
C
Sequence Type mRNA
Unitrap ID UNI30485

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 77314114..77332073 248
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071252 (2210408I21Rik) NP_001074822 RIKEN cDNA 2210408I21 gene Gene [Source:MGI Symbol;Acc:MGI:1919621]

 
Come back to gene ENSMUSG00000071252


For any suggestions or comments, please send an email to unitrap@crg.es