Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone Ayu21-T323
Clone ID Ayu21-T323
Vector 21-T323GenetrapVector
Project egtc

Sequence tag Ayu21-T323
Sequence
CGGGAGAGCGCGGTGTCCAGAGCCCGGCTCGGAGCGGCGGCGAGCAGCGTCCTTG
Sequence Type mRNA
Unitrap ID UNI30487

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 62180894..62180948 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028393 (Alad) NM_008525 aminolevulinate, delta-, dehydratase Gene [Source:MGI (curated);Acc:Alad-001]

 
Come back to gene ENSMUSG00000028393


For any suggestions or comments, please send an email to unitrap@crg.es