Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone Ayu21-T330
Clone ID Ayu21-T330
Vector 21-T330GenetrapVector
Project egtc

Sequence tag Ayu21-T330
Sequence
CACCCGCAGCTGCGGTCTAGCTGAGCAGTTGGCTACAGTTGTTGCAACTTTTTTCGAAAGCTGGGTTTCCCGGGAGATTC
CAGGCGGGACAGAGCCCGGCCAGGCTAGAG
Sequence Type mRNA
Unitrap ID UNI5356

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 124889913..124890024 104
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049327 (Setd8) NM_030241 SET domain containing (lysine methyltransferase) 8 Gene [Source:MGI (curated);Acc:Setd8-001]

 
Come back to gene ENSMUSG00000049327


For any suggestions or comments, please send an email to unitrap@crg.es