Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone Ayu21-T273
Clone ID Ayu21-T273
Vector 21-T273GenetrapVector
Project egtc

Sequence tag Ayu21-T273
Sequence
AGTCGGAGAGCAGCAGCTGGAGGAGTAGGACGTGTCGCCTG
Sequence Type mRNA
Unitrap ID UNI13542

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 8672208..8672246 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000008393 (Carhsp1) NM_025821 calcium regulated heat stable protein 1 Gene [Source:MGI Symbol;Acc:MGI:1196368]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 33904395..33904433 37
NO GENE  

 
Come back to gene ENSMUSG00000008393


For any suggestions or comments, please send an email to unitrap@crg.es