Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone Ayu21-T244
Clone ID Ayu21-T244
Vector 21-T244GenetrapVector
Project egtc

Sequence tag Ayu21-T244
Sequence
GGCATCGCGCGAGGGACGCCGCCACCTCCTCCCACGTAGCAGCCCTGTCCTCCCGCTCAGCCGCGCAGGTTGAACCCACC
AAAGCGATGGTTATGGAGAAGCCTAGTCCCCTGCTGGTCGGGCGGGAGTTCGTGCGACAGTACTACACTCTGCTGAACCA
GGCCCCGGACATGTTGCACAGATTTTATGGAAAGAACTCTTCCTATGCCCACGGGGGCTTGGATTCCAACGGGAAGCCAG
CAGATGCAGTCTACGGGCAGAAG
Sequence Type mRNA
Unitrap ID UNI2662

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 55283236..55301062 114
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018583 (G3bp1) NM_013716 Ras-GTPase-activating protein SH3-domain binding protein 1 Gene [Source:MGI (curated);Acc:G3bp1-001]

 
Come back to gene ENSMUSG00000018583


For any suggestions or comments, please send an email to unitrap@crg.es