Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone Ayu21-T290
Clone ID Ayu21-T290
Vector 21-T290GenetrapVector
Project egtc

Sequence tag Ayu21-T290
Sequence
GCCCCCCGCCCGCGCCGTCGCCCCCGACGGGGAGGACCATGGCGAAGGTGGAACAGGTCCTGAGCCTCGAGCCACAACAC
GAGCTCAAGTTCCGAG
Sequence Type mRNA
Unitrap ID UNI702

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 173563156..173563251 96
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054455 (Vapb) NM_019806 vesicle-associated membrane protein, associated protein B and C Gene [Source:MGI (curated);Acc:Vapb-001]

 
Come back to gene ENSMUSG00000054455


For any suggestions or comments, please send an email to unitrap@crg.es