Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone Ayu21-T288
Clone ID Ayu21-T288
Vector 21-T288GenetrapVector
Project egtc

Sequence tag Ayu21-T288
Sequence
TGAAGTTTCCAGAGGGAGAAGCCCGGCCGGCCGGCAGGGACAATGGAAGAAAGCGAAGGCCAGAAATGTGAGCCGAACCT
GCCTCCCTCCGGAGACAGCAGACAGATGCCCCAACAAGGGAGAAGCAATCTTCATGTAACATCTCAGGAAGATGCAGCAT
GCCGCAGGCCCAGGGAACGCCTTTCTAATGGAAACGCCAGGGCTCAGGTTTCCAAGCCTGCCCGAAATATCCCAAGGAGA
CACACTCTAGGTGGGCCCCGAAGTTCCAAAGAGATCCTGGGAATGCAGCCATCTGAGATGGACAGGAAGAGAGAGGCGTT
CCTAGAACATCTAAAGCAGAAGTACCCCCACCATGCCACAGCCATCATGGGCCACCAGGAGAGGCTGAGGGACCAG
Sequence Type mRNA
Unitrap ID UNI30503

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20441443..20451869 284
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]

 
Come back to gene ENSMUSG00000036617


For any suggestions or comments, please send an email to unitrap@crg.es