Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone Ayu21-T322
Clone ID Ayu21-T322
Vector 21-T322GenetrapVector
Project egtc

Sequence tag Ayu21-T322
Sequence
AGCGGTGGAAGCCCAGATAGCGGCGGAGAGGGCTTCGGATCCCATGGCGACCCCGGAGGCCAGCGGCAGTGGCGAGAAGG
TCGAGGGCTCCGAGCCCTCCGTCACCTACTACCGGNTGGAGGAGGTGGCGAAGCGAAACTCGGCGGAAGAGACGTGGATG
GTGATCCACGGGCGAGTCTACGATATCACCCGCTTCCTCAGCGAG
Sequence Type mRNA
Unitrap ID UNI19893

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109674569..109674773 203
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031924 (Cyb5b) NM_025558 cytochrome b5 type B Gene [Source:MGI Symbol;Acc:MGI:1913677]

 
Come back to gene ENSMUSG00000031924


For any suggestions or comments, please send an email to unitrap@crg.es