Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone G065C05
Clone ID G065C05
Vector U3CEO
Project ggtc

Sequence tag G065C05
Sequence
GGGGAGGTCATCTGCCAGGTGGCCGAAGGGAACAAGGAGGACGTAGACAAGGCAGTGAAGGCTGCTCGTGCAGCCTTCCA
GCTGGGCTCGCCCTGGCGCCGCATGGATGCATCTGACCGGGGCCGGCTGTTGTACCGATTGGCGGATCTCATTGAACGGG
ACCGGACTCTACCTAGCGCGCCTNNGAGTAACCCTGGGCAACGGCAAAGTNCNNANNNNTCCGTCTCGTACCTNGNNTGC
CCTGTGANNNGTGTGCACCGTNANNNNCCGACCGGTTGCCGCGTCTCCCGAAGNNNGAGATTTACCCAANNTGCCCGAAA
Sequence Type mRNA
Unitrap ID UNI10584

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 121806115..122030658 140
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029455 (Aldh2) NM_009656 aldehyde dehydrogenase 2, mitochondrial Gene [Source:MGI (curated);Acc:Aldh2-001]

 
Come back to gene ENSMUSG00000029455


For any suggestions or comments, please send an email to unitrap@crg.es