Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone Ayu21-T213
Clone ID Ayu21-T213
Vector 21-T213GenetrapVector
Project egtc

Sequence tag Ayu21-T213
Sequence
GGGGAGAAGGGCCAGTGCAGCGCCGCCACCGCCGGCAACTTTGTGAGCGAGTTCAGTACGTGCGTGAGCGAGTGAGCGGA
AAGGAGAGCGCGCGGACGACGCGCCCGGGACGCGCGGCTGCACCGGGAACCCCAGGCCAAGCG
Sequence Type mRNA
Unitrap ID UNI3108

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 83270409..83271063 83
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042700 (Sipa1l1) NM_172579 signal-induced proliferation-associated 1 like 1 Gene [Source:MGI Symbol;Acc:MGI:2443679]

 
Come back to gene ENSMUSG00000042700


For any suggestions or comments, please send an email to unitrap@crg.es