Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P069E07
Clone ID P069E07
Vector FlipROSACeoC+2
Project ggtc

Sequence tag P069E07
Sequence
ATGGGGGGAGAAGNNGTGGGATCNNTACGGGGGANNNAAGGNNAAGGNNGGGCNNGGGGGCTTNNTTTAANNACGGTGNN
GGGTGNNAGGGAAANNTAGGGGTACNNGGTCGGGCTGGAGGNNNNNGCGTGNNGGGTGAANNNNNNGAAANNNGGGTGTA
GATGTTGGNNTTCAAGGGGGGGGTNNGNNAGTAGCNNCGTGTATGGGGNNAGGTTGGAGCGNNGGAGGTTCNNGTCNNGC
GANNGTCGTGTGTTGNNGGGTNNNNGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGGAANNGGCTTTTGTTNNNC
GAGAAGGTTGTTGANNNANNTNNNNAACATCAGAGANNNNAGNNTNNNNNNGANNNNNNNNANNNTATANNNNNNNAAGA
AAAAGATNNNANNNAGTCAGCGTCGGGCGACCAATNNGATCAGAAAACTGCACCAAAGAAAAAAGGGATAGCTGTGGATT
ACCTGCCAGAGAGACAGAAGTACGAAATGCTGTGCCGTGGGGAGGGTATCAAAATGACTCCCCGGAGACAGAAAAGACTG
TTCTGCCGCTACCATGATGGGAACCGGAATCCTAAGTTCATCCTGGCCCCAGCCAAGCAGGAGGACGAGTGGGACAAGCC
CCGGATTATCCGTTTCCATGACATCATCTCTGACGCGGAGATTGAGATTGTCAAAGCCTTAGCAAAACCAAGGGTGAGCC
GAGCTACAGTACATGACCCTGAGACGGGGAAATTGACCACAGCACAGTACAGAGTATCTAAGNNNNNNNNNNNNNNNNNN
NNNACACGAA
Sequence Type mRNA
Unitrap ID UNI10592

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 58813209..58818166 178
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019916 (P4ha1) NM_011030 procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha 1 polypeptide Gene [Source:MGI Symbol;Acc:MGI:97463]

 
Come back to gene ENSMUSG00000019916


For any suggestions or comments, please send an email to unitrap@crg.es