Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P069G02
Clone ID P069G02
Vector FlipROSACeoC+2
Project ggtc

Sequence tag P069G02
Sequence
CTGTCCTCGCCCAGCTGGAGTACACTGTCAGAGGGGGGTGGCGTCGGACATGTCCAGACTGGATTTGAGTCATAACCGGT
TGTCTAACTGGAACAACACCTTGGAATCACAAACATTACAAGAACGTGTGCATCTCCAAAGAGATACACGAA
Sequence Type mRNA
Unitrap ID UNI10597

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 104301410..104315437 65
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032913 (Lrig2) NM_001025067 leucine-rich repeats and immunoglobulin-like domains 2 Gene [Source:MGI Symbol;Acc:MGI:2443718]

 
Come back to gene ENSMUSG00000032913


For any suggestions or comments, please send an email to unitrap@crg.es