Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P070C06
Clone ID P070C06
Vector FlipROSACeoC+2
Project ggtc

Sequence tag P070C06
Sequence
GCCTGGATTTGAGTCATAACCGGTTGTCTAACTGGAACAACACCTTGGAATCACAAACATTACAAGAAGTGGCAGTCTCC
AAAGAGATACACGAAC
Sequence Type mRNA
Unitrap ID UNI10597

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 104301406..104301477 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032913 (Lrig2) NM_001025067 leucine-rich repeats and immunoglobulin-like domains 2 Gene [Source:MGI Symbol;Acc:MGI:2443718]

 
Come back to gene ENSMUSG00000032913


For any suggestions or comments, please send an email to unitrap@crg.es