Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10828G6BBF1
Clone ID IST10828G6BBF1
Vector VICTR76
Project tigm

Sequence tag IST10828G6BBF1
Sequence
GANGNNNCNGCNNNNNNNGNNTNNNNNANNNANTGCTAANAATTTTATTTATCTGTTGATTTATTGGTGTTTGTTTGTTT
TGTTTTGAGACAGGGTTTTTCTATATAGCCCTGGCTGTTCTGGAACTCACTCTGTAGTCCAGGCTGTCCTGGAACTCAGA
GATCTGT
Sequence Type genomic DNA
Unitrap ID UNI10712

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 101411686..101411818 131
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017146 (Brca1) NM_009764 breast cancer 1 Gene [Source:MGI (curated);Acc:Brca1-001]

 
Come back to gene ENSMUSG00000017146


For any suggestions or comments, please send an email to unitrap@crg.es