Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P069G05
Clone ID P069G05
Vector FlipROSACeoC+2
Project ggtc

Sequence tag P069G05
Sequence
GTTTGGTTGGGTGGNNCGGGGNNGTGGGCNNGCTCCTGTTCGNNNGTCGGTGTGNNNNNNNNNNNNNNNNNNNNNNNNGT
TTGCTCGTGTGTCNNGGTTTTCTNNTTTTCTGTGGTTTGGTGNNGCCGGTGTGTTTGGCTTGTTGTCGGTGTGGGTTGGT
GGTTNNTCTGCGCGTCGGGGGNNGGTTTCTGTTTTTNNTNNCTTTTTCTTNNTTCTCNNTTTTNNNNNNNNNNCNNNNCC
CGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTTT
TTTTTTTTGGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCTCGGCAGAGACCGCGCGGACGAGCGGACGGA
GCGCCTCGCTGCCCCGCAGGTTCTCGGCCCTGGTTCTAAGATGATGGGATTGGGGAATGGGCGTCGCAGCATGAAGTCTC
CGCCCCTTATCCTGGCTGCCCTGGTGGCCTGTGTTATTGTGCTAGGCTTCAACTACTGGATTGCTAGCTCGAGAAGCGTG
GAACTCCAGACGCGCATTGTAGAGCTGGAAGGCCGGGTCCGCAGGGCGGCTGCAGAGAGAGGTGCTGTAGAGCTCAAGAA
GAATGAGTTTCAGGGTCGAGTGNNATATGCAGAGAGATCGACTTCACAGGATCCAGTTTACACGCAGATTCCAGCTCAAG
ATACTGTTATCAAGTTCACATCCATGATGCGNNNNNNNNNNNNNNNNNNNNNNACACGAAGC
Sequence Type mRNA
Unitrap ID UNI10593

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 59765564..59777140 154
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021556 (Golm1) NM_001035122 golgi membrane protein 1 Gene [Source:MGI Symbol;Acc:MGI:1917329]

 
Come back to gene ENSMUSG00000021556


For any suggestions or comments, please send an email to unitrap@crg.es