Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10614C9HMF1
Clone ID IST10614C9HMF1
Vector VICTR76
Project tigm

Sequence tag IST10614C9HMF1
Sequence
GACNNCCCGTNNNNNNNNNNNNNNNNNNNTTAAAAAAAAGAAAAGTAAAANAAAATGCCTACCATGCATAAAGGTTTANG
ATCTGTCCTCAGAATCATAGAGAAAACAACTGGTAGGGACAGCCAACTGGCTCATCCGGCAAAGGCATTTCCTGCACACG
CCTAGTAACACGAGAATGGTAACTGCTGCCAGATAAAGGTGAAAGATTTCAGCGCCACAGGGTTGTCTTGTGATCACCAC
ATCCATGCCTCCTACCCNATAATAATAAATAAAAATGTAAAAAAAAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI27189

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 8824818..8825079 256
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000010110 (Stx5a) NM_019829 syntaxin 5A Gene [Source:MGI Symbol;Acc:MGI:1928483]

 
Come back to gene ENSMUSG00000010110


For any suggestions or comments, please send an email to unitrap@crg.es