Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P069B01
Clone ID P069B01
Vector FlipROSACeoC+2
Project ggtc

Sequence tag P069B01
Sequence
GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNGTGNNGTTNNNNNGTGNNNNGGGTTTGTTNNNNTTNNNNNNNNNNNNNTTTGTTTGTTTTTNNTGTTTGTNN
NNNNNNTTNTNNNTGTNNNNGTTNNGNNGGTNTNNNNNNNGTGTTGGGNNNNTGTTTNNTNGGGNNNTTTGTNNNGTNNN
NNNNNGTTGNNNGGGGGTGTTTGGTNNNGGTNNTGTTGNNNNNNNTTTTTTTGTNNNNNNNGNNNTTTTGGNNNTATNNN
NTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGACAAGTTACACAAAGAATCGTTCTTGGCAT
TTCCATTTCTGTGAAAGGAAGTGTATTTCTCCCAATAAAACTCATCTTTAGGCTGTGCTGGTGAATCCAGACAATAGTTT
TGAAATATTAGTTGACCAGTCTGTTGTGATCAGTGGAAATTTGCTAAATGTCATGACTCCTCCTGTATACCCTTCACGTG
AAATTGAAGACCCAGAAGTCCGGAAGCCTGAAGATTGGGATGAAAGGCCCAAAATAGCAGATCCAGATGCTGTCAAGCCA
GATGTCTGGGATGAAGACGCCCTTTTTAAGATCCCAGATGAAGAGGCCACCAAGCTTGAAGGCTGGCTAGACGACGAACC
TGAGTATATTCCAGACCCTGATGCAGAGAAGCCAGAGGATTNNNNNNNNNNNNNNNNNNNNACA
Sequence Type mRNA
Unitrap ID UNI10615

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 50115261..51012205 176
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020368 (Canx) NM_007597 calnexin Gene [Source:MGI (curated);Acc:Canx-001]

 
Come back to gene ENSMUSG00000020368


For any suggestions or comments, please send an email to unitrap@crg.es