Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P069G11
Clone ID P069G11
Vector FlipROSACeoC+2
Project ggtc

Sequence tag P069G11
Sequence
TTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNTTTTTCCCCTTTTTNNNNNNNNNNNNNNNNGGGGGGCGCGCGTGGGCAGCGGGGAGCAGTTCGTGGCTAGGTTTTGG
GCTGCAGTCTGGGTCTGAAGGCGGCCGGAGCGGCTGTCTCAATTACGATGAGGCTCCTGCTGCTTCTGCTGGTGGCGGCG
TCGGCGGTGGTCCGCAGCGAGGCCTCTGCCAACCTGGGCGGCGTGCCCAGCAAGAGATTAAAGATGCAGTCCGCCACCGG
GCCGCTGCTCAAGTTCCAGATTTNNNNNNNNNNNNNNNNNNNNACACGA
Sequence Type mRNA
Unitrap ID UNI7301

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 58380567..58380794 218
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075700 (2810407C02Rik) NM_001040396 RIKEN cDNA 2810407C02 gene Gene [Source:MGI Symbol;Acc:MGI:1916477]

 
Come back to gene ENSMUSG00000075700


For any suggestions or comments, please send an email to unitrap@crg.es