Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P070C07
Clone ID P070C07
Vector FlipROSACeoC+2
Project ggtc

Sequence tag P070C07
Sequence
TTTTCNNGNNTTTTGTTACTTTTTACCGTTGGTGTTNNGTGGTNNCTCCACCATGCCAAGTGGTCCCAGGCTGCACCCAC
GACAGAAGGAGAGCAGAAGTCCCATGAAGTGATCAAGTTCATGGATGTCTACCAGCGAAGCTACTGCCGTCCGATTGAGA
CCCTGGTGGACATCTTCCAGGAGTACCCCGACGAGATAGAGTACATCTTCAAGCCGTCCTGTGTGCCGCTGATGCGCTGT
GCAGGCTGCTGTAACGATGAAGCCCTGGAGTGCGTGCCCACGTCTGTGATCAACATCCCCATGCAGATCATGCGGATCAA
ACCTCACCAAAGCCAGCACATAGGAGAGATGAGCTTCCTACAGCACAGCAGATGTGAATGCAGTGCAGTCTCCAAAGAGA
TACAG
Sequence Type mRNA
Unitrap ID UNI10626

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 46161393..46165350 193
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023951 (Vegfa) NP_001020421 vascular endothelial growth factor A Gene [Source:MGI (curated);Acc:Vegfa-003]

 
Come back to gene ENSMUSG00000023951


For any suggestions or comments, please send an email to unitrap@crg.es