Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P070H02
Clone ID P070H02
Vector FlipROSACeoC+2
Project ggtc

Sequence tag P070H02
Sequence
CTAGGTGGGTGNTCTCATAGCCNNGGCGTAGTACATCTGGGAGGCCGGCNNGGGTGGGTGGGGGNNNGCTGNNTGACGCG
TCCCCCGGCGCTTTGGGCACTGGCGCTAATTGTGAGCGANNGNNCTGGGGGTGGGAGGGGGGTGACTGNNGNNGTGTAGC
GGGGNNGTGGGNNGAGGTCTGACAGGGCGGAGGCNNCCCGGTTGGCGTCGTGNNAGGGTTGTACGCGAGATGATACGGAT
ANNCGATAGCCGCGGGGCCGGNNGGCGCGAGGGTTAANNGGCGNNGCGNNCACGGTGAGNNGTTGNNGGTGGGGNNAGGG
TNACTGGAGTCGAGTCGGGGTNNGGTGNNGGGNNGAAAATANNNNGGATTNNTAGAGATTNNTNAATACAATAGTTGAGC
TATNNNATTACATNNCTCTCAGGTGCGAGCTAGTTACTCCCTAAGTGTGGCCGGAGCAGAGTTCGTCCATCTAAAAAGGG
AGGGGTCCAAGGAGCTGAACTCCTAGCCGCCTAGATTTCCACTGTGGCTCTGGGTACGAGTGGCAGTTTCTTCTTGGGAT
TTCAGAAAGGAAACCAAGGAGGAAATAGAGCGCACCGCATCGCTGTGGGCATTAGAGAAATGGACTAAGAGCTGGGACAC
GTGGCAAAAGAAGATAGTCTTCTTCTCTCAATAGAGTGAGTGTGCAGTGCAGCCAGCAGCTCCTGCACACAGAAGAAAGC
AGGATCGCCTNNCTGTGCTGCCTCCAAGTGTTGTCCCCAAATACCACTGACCAAAAAGTGCAGTCTCCAAAGAGATACAC
GAAGCTG
Sequence Type mRNA
Unitrap ID UNI304

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 44385980..44392394 170
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051176 (Zfp42) NM_009556 zinc finger protein 42 Gene [Source:MGI Symbol;Acc:MGI:99187]

 
Come back to gene ENSMUSG00000051176


For any suggestions or comments, please send an email to unitrap@crg.es