Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P070E01
Clone ID P070E01
Vector FlipROSACeoC+2
Project ggtc

Sequence tag P070E01
Sequence
AANNNNNNCATCCTCTTCTCCAACTCTGATAATGAAAGGTCTATCCCATCCATGGTAGACGGTTTGAAACCAGGTCAGAG
AAAGGTTTTGTTTACTTGTTTCAAACGGAATGACAAGCGAGAAGTGAAGGTTGCCCAGTTAGCTGGGTCAGTGGCAGAAA
TGTCCTCTTATCACCATGGTGAGATGTCACTGATGATGACCATTATCAATTTGGCGCAGAATTTCATAGGTTCGAATAGT
ATACACTTATTCAAAGCCATCCCCCTGGAAAGGGCCCAGCACCTGCACAGCTCACGGCACCGGAGAGCCCTGGATACCAA
CTATTGCTTCNNNNNNNNNNNNNNNNNNNNNACACGAATGCCGAA
Sequence Type mRNA
Unitrap ID UNI10627

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 98867392..98868547 123
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020914 (Top2a) NM_011623 topoisomerase (DNA) II alpha Gene [Source:MGI (curated);Acc:Top2a-001]

 
Come back to gene ENSMUSG00000020914


For any suggestions or comments, please send an email to unitrap@crg.es