Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A035C03
Clone ID A035C03
Vector pT1betageo
Project ggtc

Sequence tag A035C03
Sequence
TCCGNNNNNCCCGNNNCNCNCNNTTTNNNNNCNNNCNNNGCTGTNNNTTTCGGNNGTNNNNCCNNCCCNNNNNNNNCGTT
NNNNCCCCNNNCCNNNNNNNCCCTTTCCCTTNNNNCTGTTCCCCCNNNTCNNNTCCCGCCCCCTTTTCCNNTNGCTNNNT
TTTNNNNNNTCNNNNNTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGNNNNNGGGGGGGTATNNNTAGAACCTTCGCATCAGGGAAAACAGAAAA
GGTGATCTTTCAAGCCCTCAAGGAACTAGGTCTTCCCAGTGGAAAGAATGATGAAATTGAACCTGCTGCATTTACTTATG
AAAAGTTCTATGAACTGACACAAAAGATTTGTCCTCGGACAGATATAGAAGATCTTTTTAAAAAAATCAATGGAGACAAA
ACTGATTATTTAACGGTAGACCAATTAGTGAGCTTTCTAAACGAACATCAGCGAGATCCTCGGCTGAATGAAATTTTATT
CCCATTTTATGATGCTAAAACGTAGCAAAGCCGATCACTTGGACGACGANNCTCTAAAAATAGGTCAAGAGAAAAACCTN
NNNNNNGTCCTGTATAAAGGACCCAGAGGTGTGAACCGTGNNNGGNNNGGGNNNNNNNNNNNNNNNNNNNNNNNA
Sequence Type mRNA
Unitrap ID UNI10641

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 135763995..135772889 103
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039943 (Plcb4) NM_013829 phospholipase C, beta 4 Gene [Source:MGI (curated);Acc:Plcb4-002]

 
Come back to gene ENSMUSG00000039943


For any suggestions or comments, please send an email to unitrap@crg.es