Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A021B07
Clone ID A021B07
Vector pT1betageo
Project ggtc

Sequence tag A021B07
Sequence
CGGCGTCAAGCTCCCGGCGTTGGCGCAGTTGGCGGGGCCAGTCCGGAACGTGAAGAGGTCGGAGCGGGCTACAACAGTGA
AGACGAGTATGAAGCTGCCGCAGCGCGAATCGAGGCCATGGATCCCGCCACTGTAGAACAGCAGGAACACTGGTTTGAAA
AGGCCTTGCGGGACAAGAAAGGCTTCATCATCAAGCAGATGAAGGAGGACGGTGCCTGTCTATTTCGGGCTGTAG
Sequence Type mRNA
Unitrap ID UNI5406

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7419696..7433523 141
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031154 (Otud5) NM_138604 OTU domain containing 5 Gene [Source:MGI (curated);Acc:Otud5-003]

 
Come back to gene ENSMUSG00000031154


For any suggestions or comments, please send an email to unitrap@crg.es