Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W048F02
Clone ID W048F02
Vector pT1ATGbetageo
Project ggtc

Sequence tag W048F02
Sequence
ACATACATCCTACTCANNGNNNCACCACAGTTCGCATCTTACGACCTTCTGTCTTCAGTACAAACCCACAGTGATAGCAT
GTGTATGCATTCATTTGGCTTGCAAATGGTCCAATTGGGAGATTCCTGTGTCAACAGATGGAAAGCACTGGTGGGAGTAT
GTGGACCCCACGGTTACCCTAGAGCTGCTAGATG
Sequence Type mRNA
Unitrap ID UNI10645

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 129695964..129696130 165
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026349 (Ccnt2) NM_028399 cyclin T2 Gene [Source:MGI (curated);Acc:Ccnt2-002]

 
Come back to gene ENSMUSG00000026349


For any suggestions or comments, please send an email to unitrap@crg.es