Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13094H9HMF2
Clone ID IST13094H9HMF2
Vector VICTR76
Project tigm

Sequence tag IST13094H9HMF2
Sequence
TNNNNNNNNNNNANNNNNNNNNNNGTCNAAGGNAAGGTGGTGAGGAAGCTACCTNNCCANCCCGGCTTCCTTTGCTTCTA
CCTGCCCAGCAATTGGCTTTGGGACGTACGTTACTACTGCTGCGACTAGTCGTCCAATTATTAAAGAAACTTTGTGCTGT
GTGTCTAGGAAACTTGTTTATAAAACTCCTGTTACGGTAGAAATCCAGTACTGGGGGCAGGCAAAGTATAGGAAACCAGG
CATTGACAACTTCCCAGCAGTTATACATCCAGGAACACCTTGTAGCTTGTAGAGCGAAGCCTCGCTCTAACCNGCAGTGG
TTGGCTGGGCTTGCTGCANTCCTTCTGGCTGCANAAACCCCAGAAATGTGCTCCAAGTCTGAAAGCTGGCCTTCTGACAT
CTTGGA
Sequence Type genomic DNA
Unitrap ID UNI510

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 114813657..114814037 365
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042348 (Arl15) NM_172595 ADP-ribosylation factor-like 15 Gene [Source:MGI Symbol;Acc:MGI:2442308]

 
Come back to gene ENSMUSG00000042348


For any suggestions or comments, please send an email to unitrap@crg.es