Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D042B07
Clone ID D042B07
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D042B07
Sequence
TCCCTCGCCATCACACTGACATGAGTGTGGGTCTTCCTGGTCCCCACAGTTTGCCTAGTTCTGAGGAAGCATCGAATTCT
GGGAACGCCTCATCAATGCCTGCAGTTTTTCATCCCGAGAACTATTCTTGCTTACAAGGGTCTGCTACTGAGATGCTCTG
CACAGAGGCTG
Sequence Type mRNA
Unitrap ID UNI10653

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 122657781..122657951 171
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000012396 (Nanog) NM_028016 Nanog homeobox Gene [Source:MGI (curated);Acc:Nanog-003]


SPLK-Sequence tag 3SD042B07
Sequence
ATTAACTGGACCCTCTGACTGGCTGCTCTTGTACTAGCAGAAAAGATGGTGGGATATTTTTAT
Sequence Type genomic DNA
Unitrap ID UNI10653

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 122659323..122659385 63
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000012396 (Nanog) NM_028016 Nanog homeobox Gene [Source:MGI (curated);Acc:Nanog-003]

 
Come back to gene ENSMUSG00000012396


For any suggestions or comments, please send an email to unitrap@crg.es