Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12151E2BBR1
Clone ID IST12151E2BBR1
Vector VICTR76
Project tigm

Sequence tag IST12151E2BBR1
Sequence
GNGGGNTCTTTNNTCNNGCACCCACATAAAAGTTGTGGACATGGCCCAAGTACTTGTAAGCCCAATGCTGGTGGAACAGA
GACAAATAGATCCTAGGAGTTCACTGGCTGGCCAGCCTAGTTGAATTGGTGAGGCTCAATAAAGACCCTGTCTCAAGGGG
TANGCANANAACGACAAAGCACAACAAGACGCCTCATGTTCTCCGTTGGTCTCCTCCACACATCACATATGCCTAGTGGT
GGACACATGCCCACACCCCATACAAGTATGAAGGAANAATATGGATTGTANCATGANACTTGAGGACATCTCCTCCAGGT
TAAAACCNTGTCTCTGTGGGANGCANNTCC
Sequence Type genomic DNA
Unitrap ID UNI24688

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 102160748..102161075 312
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001289 (Pfdn5) NM_027044 prefoldin 5 Gene [Source:MGI Symbol;Acc:MGI:1928753]

 
Come back to gene ENSMUSG00000001289


For any suggestions or comments, please send an email to unitrap@crg.es