Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12177E12BBR1
Clone ID IST12177E12BBR1
Vector VICTR76
Project tigm

Sequence tag IST12177E12BBR1
Sequence
CANNNNNNNGCNNTTGGTGACTCCCANACCCCAACTGTTACTGACACACGGTGGTCATGGAACATCAGATTGTGCCCCCA
CAGTCCTTCTCTAGCTCCCTTTTGAATCTGGCATCATTCCTAACTTCATTTAGAGCCNAGCGCTGGATAAAG
Sequence Type genomic DNA
Unitrap ID UNI30554

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 10888933..10889070 130
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024670 (Cd6) NM_009852 CD6 antigen Gene [Source:MGI Symbol;Acc:MGI:103566]

 
Come back to gene ENSMUSG00000024670


For any suggestions or comments, please send an email to unitrap@crg.es