Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12222A3HMR1
Clone ID IST12222A3HMR1
Vector VICTR76
Project tigm

Sequence tag IST12222A3HMR1
Sequence
TACAGGTGGGNTCTTTNNNNAGTGTCTGAGAAAGGTCCTGTTTTGGGCCTTCTTCTTCGGCCNGGAGGAGGTCCAAATAC
AAGATATCTGCGCACCTTCCCTGTAAGAGAGCTTGCCAGCAGAGAGTGCTCTGAGCACTGAAACTCANAGGAGAGAATCT
GTCTCCCAGGTCTGCTGATAGACGGTAACAGAATCACCAGAAGAACAATCTCTAAACANANTCC
Sequence Type genomic DNA
Unitrap ID UNI30565 UNI30566

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166309: 114605..114807 195
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166307: 48134..48336 195
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 20647562..20647764 195
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 17152828..17153030 195
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 13282633..13282835 195
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 19145505..19145707 195
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 4369649..4369851 195
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 6672739..6672941 195
 
EST/CDNA Est Name
  AA088077.1 - CB272803.1 - AA066383.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 9689690..9689892 195
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 7826469..7826671 195
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 4771173..4771375 195
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025892 (Gria4) NM_019691 glutamate receptor, ionotropic, AMPA4 (alpha 4) Gene [Source:MGI Symbol;Acc:MGI:95811]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 7461978..7462180 195
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056940 (AC127584.3) NP_001019883 Putative uncharacterized protein LOC544988 [Source:UniProtKB/TrEMBL;Acc:Q7TMK7]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 5255609..5255811 195
 
EST/CDNA Est Name
  AA088077.1 - CB272803.1 - AA066383.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 3912877..3913079 195
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 3770461..3770663 195
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 5110466..5110668 195
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 3987268..3987470 195
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 12252518..12252720 195
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 4442637..4442839 195
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 4906368..4906570 195
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 14209556..14209758 195
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 11616222..11616424 195
NO GENE  

 
Come back to gene AA088077.1 - CB272803.1 - AA066383.1


For any suggestions or comments, please send an email to unitrap@crg.es