Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13024B2HMF2
Clone ID IST13024B2HMF2
Vector VICTR76
Project tigm

Sequence tag IST13024B2HMF2
Sequence
ANNNCNGTTNTNANCTNNNNANGNTGTCTCTGATTGTGACTTATCCCTCCTGCANGCCCATGTGTCANTACTCCTGGGAN
ACTAGTTCAGCCCTGGTTTGTANACNNAAACCGGAAGGATCCTGTTCCTGGCTACTCCTTGGTTCCTGTGTCCTGAGGAT
TCTGAGTGGGTCCCTCCGAGCANAAGTGGTGGTCTTATCTGTGCCCACAGGTGTGTCAGCCTTCCTGT
Sequence Type genomic DNA
Unitrap ID UNI30571

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 39150946..39151148 187
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037386 (Rims2) NM_053271 regulating synaptic membrane exocytosis 2 Gene [Source:MGI Symbol;Acc:MGI:2152972]

 
Come back to gene ENSMUSG00000037386


For any suggestions or comments, please send an email to unitrap@crg.es