Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13014D10HMF1
Clone ID IST13014D10HMF1
Vector VICTR76
Project tigm

Sequence tag IST13014D10HMF1
Sequence
ANNNNNNNNNNNNTTNNNNNNNNGNNNATTTAACGTGGCCTTCTGGATGCGCTGAGATACCAAAGGAAGGCATCCTTCTT
TGTTTCTGCCCTGAGCTTGCACGGTGCTGGTAANTGAGTGAGGAGGTTATTGCTTTAACAGGGTATAGGCTCCAGCCTTC
CT
Sequence Type genomic DNA
Unitrap ID UNI30573

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 81920478..81920611 130
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031681 (Smad1) NM_008539 MAD homolog 1 (Drosophila) Gene [Source:MGI (curated);Acc:Smad1-001]

 
Come back to gene ENSMUSG00000031681


For any suggestions or comments, please send an email to unitrap@crg.es