Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone G015C03
Clone ID G015C03
Vector U3CEO
Project ggtc

Sequence tag G015C03
Sequence
TTGATGACACAGCCTGCCCACTTCTGAGGAAAACCTGCAACCCAGAGACCTTCCCCTTGCGGAATGAGAGCCTCCAGTGT
CCCACTGCCCGCTGCCAGTTTGCCTTCTATGGGGCGAATCGACCTACCACCGTGCCCTGCGGGCCTCAGATCTCA
Sequence Type mRNA
Unitrap ID UNI10667

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21150391..21151241 99
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000057193 (Slc44a2) NM_152808 solute carrier family 44, member 2 Gene [Source:MGI Symbol;Acc:MGI:1915932]

 
Come back to gene ENSMUSG00000057193


For any suggestions or comments, please send an email to unitrap@crg.es