Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A042A03
Clone ID A042A03
Vector pT1betageo
Project ggtc

Sequence tag A042A03
Sequence
CCGGTAGTTTCTTCATCGTCGGAGAGTAAGGGAGGCTTCTTGGGCATGGAGAGCAGAAACTCTAGTCTCAGAAATGACAT
CTCTCCTCTGTACAATGGTTCTCATCTGAGCTCAGGGCTACCAAGTTGCCTGCTGGCTTCAAACCATTATGTGGACAAAA
GGATCCTACAGAAGAAATGGTAATTCTCCAGTTGCTTCCTGAGGTGTCCAGTTGTGCCCTATGGAGATCCAATTCAGTTA
CGAATCTCAAGACCATCACTTTCTGTCAG
Sequence Type mRNA
Unitrap ID UNI1806

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 24148177..24148891 215
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063281 (Zfp35) NM_011755 zinc finger protein 35 Gene [Source:MGI Symbol;Acc:MGI:99179]

 
Come back to gene ENSMUSG00000063281


For any suggestions or comments, please send an email to unitrap@crg.es