Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone DD0645
Clone ID DD0645
Vector pGT1lxrT2
Project sanger

Sequence tag DD0645
Sequence
CTTATTCCTTCTCTCTCATTGGCGCAGCAAGGTACCTTTAAAACAAGGCAGGAGTCTTATGGATTGGATCCGACTGACCA
AGAGTGGAAAGGACTTAACAGGATTGAAGGGTGGGTTAATTGAAGTAACTGAAGAAGAGCTTAAGAAGCACAACAAGAAA
GAAGATTGTTGGATATGCATAAGAGGGTTTGTTTACAACGTCAGCCCTTATATGGAGTACCATCCGGGTGGGGAGGATGA
ACTCATGAGAGCCGCAGGAGCCGATGGAACAGATCTTTTTAATGAGGTTCATCGTTGGGTCAATTATGAATCCATGCTGA
AAGAATGCCTGGTTGGCAGGATGGCTGTGAAGCCTGCTGTTCCAAAAG
Sequence Type mRNA
Unitrap ID UNI1261

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 86921780..86927296 155
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032872 (Cyb5r4) NM_024195 cytochrome b5 reductase 4 Gene [Source:MGI Symbol;Acc:MGI:2386848]

 
Come back to gene ENSMUSG00000032872


For any suggestions or comments, please send an email to unitrap@crg.es