Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12579C2BBF1
Clone ID IST12579C2BBF1
Vector VICTR76
Project tigm

Sequence tag IST12579C2BBF1
Sequence
ATTGANTACCCGTCNGCGGGGGTNTTTNATTANGAATATAAATTGAGAATGAAAAGAGAAACCAGTTAGAACCNGCAAGA
TGGTTCAACAGATAAAGGGATTCATTGTTGCCTGTAAACCTGCAAACAAGGCACAGTTTAATCCTANCACTCAAGAGTCA
AAAGTGCAGCACGCCCGCCACCGGAAGTTTTTGGTGCATTTCTCTCTATGGACTCCTGACAAATGCAGCTCACCTATGCA
GTGTAAGGCCGACCNATACATGCATGTTGCTAGCAAAGAATCTTTCATCACCTGTCCGTTCATGTGCTTGCTTTANCAGA
ACATCCTCTCTCCTGTGTCTGCTTCAGTGAAACGTTCCTTCACCAGTCGGCCTTANCCTTTCACCTGTGTCCNCTTTAAC
CNAACGTTCCTTCACGTGGTTGCCCCANCAAAACACATCCAACCAACTTCCCAAATAACCCTTAAGTTTCCNCGTCGCNA
GCCGGGCATGGTGGCTCATGCCTTTAATCCCAGCACTNGGNA
Sequence Type genomic DNA
Unitrap ID UNI26976

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 57423963..57424453 467
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031139 (Mcf2) NM_133197 mcf.2 transforming sequence Gene [Source:MGI (curated);Acc:Mcf2-001]

 
Come back to gene ENSMUSG00000031139


For any suggestions or comments, please send an email to unitrap@crg.es