Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12559F11BBF1
Clone ID IST12559F11BBF1
Vector VICTR76
Project tigm

Sequence tag IST12559F11BBF1
Sequence
ATNGANNACCCGNNNGCGGGGGNCNNTCAGGTCCATGCTGACTTCCCACTAATTNANCTAAAAGACTGCANNNCCNGGAA
ATGAAACCATTCCGCCATTGACTTTCGCATCCTAGTGCCTATAAAAGATGTTTAAATGTTCGTTGGCTTTAAGTGGATGC
TTAAGTGAACAGTGTGTTTCTGGCCCAACTATGTCAAGTCTTTCTTCACTAAGTACTCCACCCATGAAGGATTCAGCTCT
CATCAGAAACCCATGAGCACCCATCAGACCTCGGCATAACTTANACGACAGAGGAGAAAAATCGGAAGCCCTGGGCAGCA
TTGCACTTGACAAATATGGGCCTCAAAACAAACAAAAAAGATCAGAACAGGAAGCATCCNATAGGATTCATGAAGAGCCC
TAAAGGAAAAAGATGCGACAATGTGGGAAAAGGGTAAAGAGCCNNNAGCNGCCCCAAACAATCCATGTGTTTCTTTTGAG
TCCTCTCTGTCAAAACCACTGCATTTTGGCATTGNTCCTGNGTATATCACATTTNATCCCCNCCNCTGCTGAATAAA
Sequence Type genomic DNA
Unitrap ID UNI22139

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 57088794..57089322 491
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054181 (A930012O16Rik) RIKEN cDNA A930012O16 gene Gene [Source:MGI Symbol;Acc:MGI:2442255]

 
Come back to gene ENSMUSG00000054181


For any suggestions or comments, please send an email to unitrap@crg.es