Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12857G1BBF1
Clone ID IST12857G1BBF1
Vector VICTR76
Project tigm

Sequence tag IST12857G1BBF1
Sequence
ANCNACGGNNNCGANAANNCCNNNNNANNCCTTGGGCAGGAGAAGGAAAATTAGTCAACAGCTAATTGGATATCAATTTC
TGCAACATGTGATTTGAACCTTTTTAAGAAACTGGCCTTTTCTAGTGCCAGCTTCTCAAAAGAGATTGAACTAGCTTTAA
TAACATTGAGTTTAAAAGAGAGAGCACTTTTAAGGCAGGTGTTGTGGTGCACGCTTTTAATCCCAGCATTTGGGAACCTT
AGGCAGGTAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI26806

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 40548333..40548557 225
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020328 (Nudcd2) NM_026023 NudC domain containing 2 Gene [Source:MGI (curated);Acc:Nudcd2-001]

 
Come back to gene ENSMUSG00000020328


For any suggestions or comments, please send an email to unitrap@crg.es