Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone F046F01
Clone ID F046F01
Vector pT1ATGbetageo
Project ggtc

Sequence tag F046F01
Sequence
TGCATGCAGACATCAGTGTACCCTTTCCAGAGGGATTTGTAATCGCAAATGACGTGGACAACAAGCGCTGCTATCTGGTC
GTCCATCAGGCCAAAAGGTTGAGCAGTCCCTGCATCATGGTGGTAAACCATGACGCATCCAGCATACCTAGACTTACAGT
AGATGTGGACGGAAGGAAAGAGATTCTCTTCTATGATCGAATTTTATGTGATGTCCCTTGCAGTGGCGATGGCACAATGA
GAAAAAACATTGATGTCTGGAAGAAATGGACAACCTTAAACAGCTTGCAGCTCCATGGCCTGCAGCTTCGGATGCAACCC
NNNNNNNNNNNNNAGACCTACCAGGCC
Sequence Type mRNA
Unitrap ID UNI10691

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 69757039..69760557 194
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021595 (Nsun2) NM_145354 NOL1/NOP2/Sun domain family member 2 Gene [Source:MGI (curated);Acc:Nsun2-002]

 
Come back to gene ENSMUSG00000021595


For any suggestions or comments, please send an email to unitrap@crg.es