Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12758A7BBF1
Clone ID IST12758A7BBF1
Vector VICTR76
Project tigm

Sequence tag IST12758A7BBF1
Sequence
GACNACCNGNNNNNGGGGGNNNNTCANTATCGGCTTTTTAGTTTTTAGATTTGTCTTCTTGTTCTTCAGTGCTCGAGCAC
AGGTAGCTTTCTCTCTCTCCTTCCCTGCCTGTCGGCACTGCAATTCCAGTTTGTTACTGACTCGTTTTGCTTGAGGCTGA
ATAACTGTTGTTANCCTGCTGAGCTTTCTAACATCTCATACTCNGGCGATTTCTGGTNNGANNTGATTCTTANNTTNTNA
NNCNCTT
Sequence Type genomic DNA
Unitrap ID UNI30606

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 58520897..58521101 193
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074269 (2410076I21Rik) RIKEN cDNA 2410076I21 gene Gene [Source:MGI Symbol;Acc:MGI:1920923]

 
Come back to gene ENSMUSG00000074269


For any suggestions or comments, please send an email to unitrap@crg.es