Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M052A06
Clone ID M052A06
Vector U3betageo
Project ggtc

Sequence tag M052A06
Sequence
CCGCCCATGGACTGCCCTTCAGCCATTTACCAGGTCACGATGCAGTGCTGGCAGCAAGAGCGCTCCCGCCGGCCCAAGTT
NNNCGACATCGTTAGCATCCTGGACAAGCTCATCCGAGCCCCCGACTCCCTCAAGACGCTGGCTGACTTCGATCCCCGAG
TGTCCATCCGGCTGCCCAGCACCAGCGGCTCGGAGGGAGTCCCCTTCCGTACGGTGTCCGAGTGGCTGGAGAGCATCAAG
ATGCAACAGTACACGGAACACTTCATGGTGGCTGGCTACACGGCCATCGAGAAGGTGGTACAGATGTCCNNGAG
Sequence Type mRNA
Unitrap ID UNI10692

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 140879365..140880297 159
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006445 (Epha2) NM_010139 Eph receptor A2 Gene [Source:MGI (curated);Acc:Epha2-001]

 
Come back to gene ENSMUSG00000006445


For any suggestions or comments, please send an email to unitrap@crg.es