Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M019B05
Clone ID M019B05
Vector U3betageo
Project ggtc

Sequence tag M019B05
Sequence
CGGACAGCCCCACGCGGACCCCGACCCGACAACCGCGGAGGAGGATGAACCGGGGCTCGCTAGGGGGGCGGCCGTAGCCG
AGGCCTCTTAGTTCTGCGGCACGTGACGGTCGGGCCGCCTCTGCCGCTGTCTCCACTGCAGCACGGGGCCGGGTGTGCGT
GTGGGAGAAGGTGAGGGAGCCGCCAGTGGTCCCCGGGAGGCTCGAGGTGAGACGGGAAGNNNT
Sequence Type mRNA
Unitrap ID UNI6711

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 50138982..50139149 160
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020368 (Canx) NM_007597 calnexin Gene [Source:MGI (curated);Acc:Canx-001]

 
Come back to gene ENSMUSG00000020368


For any suggestions or comments, please send an email to unitrap@crg.es